DNA to Protein Translator
This tool converts DNA or RNA sequences into protein chains using the standard genetic code. Enter your nucleotide sequence and get the translated amino acid chain instantly.
Sequence Input
Spaces and numbers will be automatically removed.
Example Sequences
Human insulin (partial):
ATGGCCCTGTGGATGCGCCTCCTGCCCCTGCTGGCGCTGCTGGCCCTCTGGGGACCTGACCCAGCCGCAGCCTTTGTGAACCAACACCTGTGCGGCTCACACCTGGTGGAAGCTC
GFP (partial):
ATGGTGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAG
Protein Sequence
Translated protein will appear here...
Codon Table
| 1st Base | 2nd Base | 3rd Base | |||
|---|---|---|---|---|---|
| T | C | A | G | ||
| T | TTT (F) | TCT (S) | TAT (Y) | TGT (C) | T |
| TTC (F) | TCC (S) | TAC (Y) | TGC (C) | C | |
| TTA (L) | TCA (S) | TAA (*) | TGA (*) | A | |
| TTG (L) | TCG (S) | TAG (*) | TGG (W) | G | |
| C | CTT (L) | CCT (P) | CAT (H) | CGT (R) | T |
| CTC (L) | CCC (P) | CAC (H) | CGC (R) | C | |
| CTA (L) | CCA (P) | CAA (Q) | CGA (R) | A | |
| CTG (L) | CCG (P) | CAG (Q) | CGG (R) | G | |
| A | ATT (I) | ACT (T) | AAT (N) | AGT (S) | T |
| ATC (I) | ACC (T) | AAC (N) | AGC (S) | C | |
| ATA (I) | ACA (T) | AAA (K) | AGA (R) | A | |
| ATG (M) | ACG (T) | AAG (K) | AGG (R) | G | |
| G | GTT (V) | GCT (A) | GAT (D) | GGT (G) | T |
| GTC (V) | GCC (A) | GAC (D) | GGC (G) | C | |
| GTA (V) | GCA (A) | GAA (E) | GGA (G) | A | |
| GTG (V) | GCG (A) | GAG (E) | GGG (G) | G | |
What Is DNA Translation?
DNA translation is the process by which the genetic code within a DNA or RNA sequence is converted into a sequence of amino acids, the building blocks of proteins. This is a fundamental process in molecular biology, central to the expression of genes into functional proteins.
The Translation Process
- Transcription: DNA is first transcribed into messenger RNA (mRNA) in the nucleus of the cell.
- Reading Frames: The mRNA is read in groups of three nucleotides, called codons, starting from the start codon (usually AUG in RNA, which corresponds to ATG in DNA).
- Amino Acid Chain: Each codon specifies a particular amino acid according to the genetic code, and amino acids are joined together in the order specified by the mRNA.
- Termination: Translation continues until a stop codon (UAA, UAG, or UGA in RNA) is encountered, which signals the end of the protein.
Important Notes
- Start codons: ATG (DNA) or AUG (RNA) code for Methionine and typically indicate the start of a protein.
- Stop codons: TAA, TAG, TGA (DNA) or UAA, UAG, UGA (RNA) signal the end of translation and are represented by an asterisk (*) in the output.
- Reading frames: DNA can be read in 3 different frames by shifting the starting position, potentially yielding different amino acid sequences.
- Open Reading Frames (ORFs): Sequences that start with a start codon and end with a stop codon, potentially encoding complete proteins.